Top > Search of International Patents > Immunostimulating agents

Immunostimulating agents achieved

Foreign code F110003530
File No. B18-01WO
Posted date Jun 28, 2011
Country United States of America
Application number 55710804
Gazette No. 20080262210
Gazette No. 7790189
Date of filing May 13, 2004
Gazette Date Oct 23, 2008
Gazette Date Sep 7, 2010
International application number JP2004006793
International publication number WO2004100965
Date of international filing May 13, 2004
Date of international publication Nov 25, 2004
Priority data
  • P2003-136876 (May 15, 2003) JP
  • 2004WO-JP06793 (May 13, 2004) WO
Title Immunostimulating agents achieved
Abstract (US7790189)
Disclosed is a new type of immunostimulating agent including an immunostimulating oligonucleotide complexed with a carrier which is safe and has a high transfection effect.
The carrier complexed with the immunostimulating oligonucleotide to form the immunostimulating agent is a polysaccharide having &bgr;-1,3-bonds (preferably &bgr;-1,3-glucan such as schizophyllan).
A preferred example of the immunostimulating oligonucleotide is one containing an unmethylated CpG motif.
The polysaccharide for use is preferably modified with nucleic acid-binding functional group and/or cell membrane-affinitive functional group.
Scope of claims [claim1]
1. An immunostimulating agent which comprises a complex of an immunostimulating oligonucleotide of 8 to 100 nucleotides which contains an unmethylated CpG motif and a polysaccharide having beta -1,3-bonds.
[claim2]
2. The immunostimulating agent of claim 1, wherein the phosphoric acid backbone of the oligonucleotide is phosphorothioate-modified or phosphorodithioate-modified.
[claim3]
3. The immunostimulating agent of claim 1, wherein the polysaccharide having beta -1,3-bonds is beta -1,3-glucan or beta -1,3-xylan.
[claim4]
4. The immunostimulating agent of claim 1, wherein the beta -1,3-glucan is selected from among schizophyllan, curdlan, lentinan, pachyman, grifolan, laminaran and scleroglucan.
[claim5]
5. The immunostimulating agent of claim 1, wherein the polysaccharide is modified with nucleic acid-binding functional group and/or cell membrane-affinitive functional group.
[claim6]
6. The immunostimulating agent of claim 1, wherein the complex of the oligonucleotide and the polysaccharide is of a triple helix structure formed through hydrogen bonds and hydrophobic interactions.
[claim7]
7. The immunostimulating agent of claim 1, wherein said unmethylated CpG motif is selected the group consisting of AACGTT, AGCGTT, GACGTT, GGCGTT, AACGTC, AGCGTC, GACGTC, GGCGTC, AACGCC, AGCGCC, GACGCC, GGCGCC, AACGCT, AGCGCT, GACGCT, and GGCGCT.
[claim8]
8. The immunostimulating agent of claim 1, wherein said immunostimulating oligonucleotide is selected from the group consisting of:
(SEQ ID NO 7)accgataccggtgccggtgacggcaccacg;(SEQ ID NO 8)accgatagcgctgccggtgacggcaccacg;(SEQ ID NO 9)accgatgacgtcgccggtgacggcaccacg;(SEQ ID NO 10)accgattcgcgagccggtgacggcaccacg;(SEQ ID NO 11)ggggggggggggcgatcggggggggggggg;(SEQ ID NO 12)gggggggggggacgatcgtcgggggggggg;(SEQ ID NO 13)ggggggggggggaacgttgggggggggggg;(SEQ ID NO 14)GAGAACGCTCGACCTTCGAT;(SEQ ID NO 15)TCCATGACGTTCCTGATGCT; and(SEQ ID NO 16)TCTCCCAGCGTGCGCCAT;
wherein capital letters denote a thiolated DNA.
[claim9]
8. The immunostimulating agent of
-- (SEQ ID NO 7)
-- accgataccggtgccggtgacggcaccacg;
--
-- (SEQ ID NO 8)
-- accgatagcgctgccggtgacggcaccacg;
--
-- (SEQ ID NO 9)
-- accgatgacgtcgccggtgacggcaccacg;
--
-- (SEQ ID NO 10)
-- accgattcgcgagccggtgacggcaccacg;
--
-- (SEQ ID NO 11)
-- ggggggggggggcgatcggggggggggggg;
--
-- (SEQ ID NO 12)
-- gggggggggggacgatcgtcgggggggggg;
--
-- (SEQ ID NO 13)
-- ggggggggggggaacgttgggggggggggg;
--
-- (SEQ ID NO 14)
-- GAGAACGCTCGACCTTCGAT;
--
-- (SEQ ID NO 15)
-- TCCATGACGTTCCTGATGCT; and
--
-- (SEQ ID NO 16)
-- TCTCCCAGCGTGCGCCAT;
[claim10]
9. The immunostimulating agent of claim 1, wherein the polysaccharide to be complexed is provided with nucleic acid-binding functional groups formed by periodate oxidation of 1,6-glucopyranoside branches followed by reductive amination.
  • Inventor, and Inventor/Applicant
  • MIZU MASAMI
  • SHINKAI SEIJI
  • SAKURAI KAZUO
  • KOUMOTO KAZUYA
  • NUMATA MUNENORI
  • MATSUMOTO TAKAHIRO
  • JAPAN SCIENCE AND TECHNOLOGY AGENCY
  • MITSUI SUGAR
IPC(International Patent Classification)
Reference ( R and D project ) SORST Selected in Fiscal 2001
Please contact us by E-mail or facsimile if you have any interests on this patent.

PAGE TOP

close
close
close
close
close
close