Top > Search of International Patents > IMPDH INHIBITOR HAVING MICRORNA AS ACTIVE COMPONENT

IMPDH INHIBITOR HAVING MICRORNA AS ACTIVE COMPONENT

Foreign code F130007397
File No. S2012-0155-N0
Posted date Jun 12, 2013
Country WIPO
International application number 2012JP079467
International publication number WO 2013/077228
Date of international filing Nov 14, 2012
Date of international publication May 30, 2013
Priority data
  • P2011-257158 (Nov 25, 2011) JP
Title IMPDH INHIBITOR HAVING MICRORNA AS ACTIVE COMPONENT
Abstract

Provided is a novel IMPDH inhibitor based on miRNA. This IMPDH inhibitor has, as an active component, oligonucleotides based more specifically on a miR-19a. The oligonucleotides based on miR-19a comprise a base sequence shown in any of 1) to 5) below: 1) the base sequence represented by sequence number 1 (UGUGCAAAUCUAUGCAAAACUGA)

2) the base sequence represented by sequence number 2 (AGUUUUGCAUAGUUGCACUACA)

a base sequence obtained by substitution, deletion, insertion, or addition of one to three nucleotides to a base sequence shown in sequences 1 or 2

base sequences complementary to the base sequences of oligonucleotides shown in any of 1) to 3) above

and base sequences which encode any of the oligonucleotides in 1) to 4) above. The aforementioned oligonucleotides suppress biosynthesis of IMPDH proteins by acting on the mRNA of the IMPDH gene, and can function as an IMPDH inhibitor.

  • Applicant
  • ※All designated countries except for US in the data before July 2012
  • NATIONAL UNIVERSITY CORPORATION OKAYAMA UNIVERSITY
  • Inventor
  • OUCHIDA, MAMORU
IPC(International Patent Classification)

PAGE TOP

close
close
close
close
close
close